What is the purpose of RT(reverse transcriptase) -PCR?
A) to conduct a PCR reaction without the use of primers
B) to follow the amount of a specific PCR product in real time
C) to quantify RNA in a cell
D) to nonspecifically amplify DNA
Correct Answer:
Verified
Q6: Select the technique that can be used
Q8: What is the origin of restriction endonucleases?
A)
Q9: DNA ligase is needed in a cloning
Q10: Site-directed mutagenesis allows researchers to produce a
Q11: A plasmid that contains separate origins of
Q12: A cDNA library differs from a genomic
Q14: What occurs during the annealing stage of
Q16: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you
Q19: Which of the following is an example
Q20: What is the purpose of RNaseH in
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents