A cDNA library differs from a genomic library in which way?
A) It consists solely of RNA molecules.
B) It contains many copies of the gene of interest.
C) It contains only coding sequences, not introns.
D) It is typically 10-100 times the size of a DNA library.
Correct Answer:
Verified
Q8: What is the origin of restriction endonucleases?
A)
Q9: DNA ligase is needed in a cloning
Q10: Site-directed mutagenesis allows researchers to produce a
Q11: What is the purpose of RT(reverse transcriptase)-PCR?
A)
Q11: A plasmid that contains separate origins of
Q14: What occurs during the annealing stage of
Q16: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you
Q17: cDNA is made using what as the
Q19: Which of the following is an example
Q20: What is the purpose of RNaseH in
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents