Question 1

Knowing an individual's DNA sequence may be beneficial because it makes it possible to predict:

Accepted Answer

Knowing an individual's DNA sequence can help predict susceptibility to disease, response to medications, and physical differences. It can also help predict the occurrence of certain diseases based on genetic predispositions. Therefore, all of these choices are correct.

Question 2

In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the underlined regions organized relative to one another? ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

Accepted Answer

The answer of In the eukaryotic DNA sequence below, each...

Question 3

A baby was born whose biological mother and father each donated a set of chromosomes, and an unrelated woman donated the mitochondria. How many "genomes" did this child inherit? How many "genomes" does the child have?

Accepted Answer

The child inherited two sets of chromosomes, one from the biological mother and one from the biological father, making a total of two genomes. However, since the mitochondria were donated by an unrelated woman, there is only one genome in terms of mitochondrial DNA. Therefore, the child has three genomes in total.

Question 4

Which one of the following pairs of people has the exact same genome?

Accepted Answer

Identical twins share the exact same genetic material as they develop from a single fertilized egg that splits into two.

Question 5

Which one of the following statements about an open reading frame is TRUE?

Accepted Answer

An open reading frame is a DNA sequence that can potentially encode a protein, and it consists of codons for amino acids that are uninterrupted by a stop codon. Therefore, all three statements are true.

Question 6

"Shotgun" sequencing involves aligning many small sequences from a genome based on sequence similarities.

Accepted Answer

Shotgun sequencing does indeed involve aligning many small sequences from a genome based on sequence similarities. This approach allows for the faster and more cost-effective sequencing of large genomes than traditional sequencing methods.

Question 7

A possible negative consequence of personalized medicine could be:

Accepted Answer

One of the possible negative consequences of personalized medicine is the difficulty obtaining insurance if susceptibility to disease becomes public information. Insurance companies may deny coverage or charge higher premiums to individuals who are genetically predisposed to certain diseases, potentially leading to discrimination and inequality in healthcare access.

Question 8

Sequence assembly is accomplished by aligning the fragments:

Accepted Answer

Sequence assembly is typically accomplished using a complex computer program that aligns the fragments based on their overlapping regions. This process involves identifying and resolving discrepancies in the alignment, which can be caused by sequencing errors or variations in the genome being sequenced. While gel electrophoresis and other laboratory techniques can be used to generate DNA fragments for sequencing, they do not directly contribute to the process of assembly. Joining histones is not relevant to sequence assembly.

Question 9

Which one of the following types of sequences can be found in a genome?

Accepted Answer

All of these types of sequences can be found in a genome. Regulatory elements control the expression of protein-coding genes, while noncoding introns are found within genes and are transcribed but not translated into proteins. Protein-coding exons contain the code for amino acid sequences that make up proteins, and coding sequences for RNAs include tRNA, rRNA, and mRNA.

Question 10

The human chromosome 1 is approximately 250 million nucleotides long. In order to sequence human chromosome 1, the chromosome is broken up into hundreds of small fragments. These short fragments are placed together in the correct order to generate the long, continuous sequence of nucleotides in chromosome 1. Placing these fragments together is referred to as sequence:

Accepted Answer

The process of placing short fragments in order to generate a long continuous sequence is referred to as sequence assembly. Therefore, the best choice is C - assembly.

Question 11

Knowledge of your personal genome:

Accepted Answer

Personal genomic information can identify genetic risk factors for certain diseases, which can help individuals make informed decisions about their health, such as choosing to modify certain lifestyle choices or starting preventative measures earlier. It does not, however, predict with certainty which diseases a person will get or which lifestyle choices are safe.

Question 12

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats.

Accepted Answer

Tandem repeats are multiple copies of a sequence that are adjacent to each other, while dispersed repeats are copies of a sequence that are scattered throughout the genome.

Question 13

All of the genetic material transferred from a parent to an offspring is known as a:

Accepted Answer

The term "genome" refers to the complete set of genetic material in an organism, including all of the genes and non-coding sequences. Therefore, all of the genetic material transferred from a parent to an offspring can be described as the offspring's genome.

Question 14

What was the goal of the Human Genome Project?

Accepted Answer

The goal of the Human Genome Project was to sequence every gene in the human cell.

Question 15

Which of the following statements is TRUE regarding a genome?

Accepted Answer

Genomes are heritable as they contain the genetic information passed from parents to offspring.

Question 16

Except for twins and other multiple births, the genome sequence is different in every individual.

Accepted Answer

Each person has a unique set of genetic material that differs from others, except in the case of identical twins who come from a single fertilized egg that splits into two embryos, resulting in both individuals having the same genetic material.

Question 17

Repeated sequences make genome sequencing challenging for of all of the following reasons EXCEPT:

Accepted Answer

The statement "the long repeats often have mutations that are not easily sequenced" is incorrect. The mutations within repeated sequences are often useful for identifying different copies of the same repeat, as they accumulate changes over time due to their high rate of recombination. The other statements are all true and contribute to the difficulty of sequencing repeated sequences.

Question 18

Which one of the following represents a consequence of sequencing an organism's genome?

Accepted Answer

Sequencing an organism's genome allows for personal genome analysis for disease potential (A), comparison among species for evolutionary studies (B), and annotation for identifying genes and open reading frames (C). However, sequencing alone does not provide complete knowledge of protein expression and behavior (D).

Question 19

Analysis of similarities and differences in the genomes of different species is referred to as:

Accepted Answer

Comparative genomics involves analyzing the similarities and differences in genomes of different species to understand evolutionary relationships, gene function, and potential applications in fields like medicine and biotechnology. Sequence assembly and genome annotation are specific steps in the process of genome sequencing, while personalized medicine focuses on tailoring medical treatments to an individual's genetic makeup. Genome conservation is related to efforts to protect and preserve the genetic diversity of species and ecosystems.

Question 20

An individual's genome sequence can reveal his or her disease susceptibilities and drug sensitivities, which allows treatments to be tailored to the individual. This approach is called:

Accepted Answer

The approach described in the question is called personalized medicine, which involves tailoring medical treatments to an individual's specific genetic makeup. This is made possible by analyzing an individual's genome sequence, which can reveal information about disease susceptibilities and drug sensitivities. The other answer options (sequence assembly, shotgun sequencing, and genome annotation) do not accurately describe this approach.

Quiz 13: Genomes