The Restriction Enzyme SmaI Cuts DNA Between the Last C

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

A) One; SmaI does not cut this piece of DNA.
B) Two; SmaI cuts this piece of DNA once.
C) Two; SmaI cuts this piece of DNA twice.
D) Four; SmaI cuts this piece of DNA four times.