Solved

Referring to the Image Above,what Is the Amino Acid Sequence

Question 40

Multiple Choice

     Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA? A) asp-gly-val-glu-glu-trp-tyr B) leu-pro-glu-leu-leu-thr-ile C) ile-thr-leu-leu-gly-pro-leu D) ser-arg-arg-met-gly-val-stop E) met-gly-val-lys-ser-gly-stop    Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?


A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents