The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
To properly align the three sequences so they can be used to make comparisons, a gap representing _______ nucleotides should be added to sequence D.erecta starting at position 4.
Correct Answer:
Verified
Q78: The voltage-gated sodium channels of neurons are
Q79: A gene family has been accumulating nucleotide
Q80: Which statement about the globin family is
Q81: When researchers apply the principles of evolution
Q82: Suppose the size of a population of
Q84: Kimura's _ theory of molecular evolution proposes
Q85: Investigations of the mechanisms and consequences of
Q86: Refer to the figure, which shows the
Q87: Refer to the figure, which shows the
Q88: Suppose the common ancestor of cows and
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents