Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A) base addition - silent
B) substitution - misense
C) base addition - missense
D) substitution - frameshift
E) base addition - frameshift
Correct Answer:
Verified
Q9: Which of the following diseases is associated
Q10: Which of the following statements about cancer
Q11: Ionizing radiation can produce which of the
Q12: A repair enzyme recognizes an incorrect structure
Q13: In the Ames test,mutagenicity is normally tested
Q15: Which of the following types of physical
Q16: Which of the following LEAST belongs with
Q17: Which of the following CANNOT be repaired
Q18: Which of the following results in a
Q19: A mutation causes a gene to become
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents