Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?
A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop
Correct Answer:
Verified
Q23: What is the genetic code?
A) all of
Q25: How many different amino acids are found
Q29: A ribosome contains _.
A) RNA only
B) DNA
Q29: What does it mean that the genetic
Q33: In prokaryotes, transcription occurs in the _.
A)
Q35: tRNA differs from other types of RNA
Q36: How many nucleotides comprise one codon?
A) 2
B)
Q37: Which enzyme unwinds the DNA during transcription?
A)
Q38: How many different codons in our genetic
Q39: Which of the following carries amino acids
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents