Solved

Four Unique Sequences Have Been Amplified Using PCR of the SSU

Question 50

Essay

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

Correct Answer:

verifed

Verified

The sequences have 29 nucleotides. The f...

View Answer

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents