This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'
Correct Answer:
Answered by Quizplus AI
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q66: Mechanisms that exist to detect and deal
Q67: Which of the following statements about translation
Q68: Which of the following statements about protein
Q69: What would be the effect on the
Q70: An auxotrophic E. coli strain requires
Q72: A yeast strain was exposed to a
Q73: An auxotrophic E. coli strain requires
Q74: Which molecule allows the release of mRNA
Q75: Which amino acids are encoded, if the
Q76: Write the codon, with correct polarity, of
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents