This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′
-If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?
A)Phe Asp His
B)Met Asn Gly Trp
C)Met Asn Gly
D)Translation will not begin.

Question

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′  
-If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?
A)Phe Asp His 
B)Met Asn Gly Trp 
C)Met Asn Gly 
D)Translation will not begin.

Quizplus · Accepted Answer

Mitochondria have their own ribosomes and genetic code, which initiates protein synthesis with methionine (Met), similar to cytoplasmic translation. The sequence provided suggests translation that starts with Met, followed by other amino acids, matching option B.

This Sequence Is the 5′ End of a MRNA: 5′