Quiz 12: Gene Transcription and Rna Modification

Biology

The parts of a gene can comprise of both structural genes and nonstructural genes. Structural genes code for proteins or polypeptides. (A)Some examples of genes which are not structural are those coding for: • tRNA: This RNA is used in the transport of amino acids to the site of protein synthesis. • rRNA: This RNA is present in the ribosomes and are helpful in protein synthesis. • snRNA: This RNA is a part of spliceosome Nonstructural genes are those which are converted into mRNA by the process of transcription. But they are not translated. (B)In the case of structural genes, the two DNA strands have two different names. One strand is called the template strand while the other strand is called the coding strand. In the case of nonstructural genes, the term template strand holds good. The term coding strand does not apply. Since the RNA from these nonstructural genes dies not code for a polypeptide or protein, the strand cannot be called a coding strand. (C)Yes, nonstructural genes also have promoters and terminators. The promoter and terminator sequences are present in the DNA sequence. Hence, as nonstructural genes are transcribed like structural genes, they also possess promoters and terminators. The RNA formed after transcription is not translated in the case of nonstructural proteins.

The cDNA (complementary Deoxyribonucleic acid) sequence of a particular gene is given below: img ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATC ACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAA TTTGTGTGTGGGTATACAGTATAATCATATA img The sequence of the genomic DNA is given: img ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATC ACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAG GTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATA CAGTATAATCATATA img The location of the intron is shown in red in the above sequence. The genomic DNA sequence contains the normal consensus splice site sequences. The three consensus sequences are the 5' splice site; the 3' splice site, and the branch site. The splice site sequences are underlined in the below sequence: img ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATC ACCCAACTCG GCCCACC CCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGT TACTT A TCC CAAAAAAACCTAGATACCCCACATACTATT AACTCTTTCTTTCTAG GTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATA CAGTATAATCATATA img The adenosine residue, which participates in the reaction is shown in bold and in red color. Yes, the above sequences fit the consensus sequences given in figure 12.21.

The process of alternative splicing occurs mainly in multicellular organisms. It differs slightly from the ordinary splicing process. In the normal splicing process, there are established introns and exons in the gene. The introns are spliced out and the exons are joined together to form the mature mRNA (messenger ribonucleic acid). In alternative splicing, various combinations of exons are seen. Variations occur in the pattern of splicing which gives rise to different types of mRNA molecules. When different types of mRNA molecules are produced, different types of proteins can be formed from one gene sequence. The biological significance of the alternative splicing process is that the genetic material in the cell can be put to good use. There can be a large number of proteins with only a small amount of genetic material. This would be an efficient method to use the genetic material. This could be a good reason to explain the existence of introns. But in some organisms, there is a large amount of junk DNA (deoxyribonucleic acid) present in the genome. Hence, we cannot say that the process of alternative splicing explains the existence of introns in the genome.