Deck 12: Mutation, DNA Repair, and Cancer

Question 1

Which of the following is true concerning a somatic cell mutation?

A)A small fraction of the gametes carry the mutation.
B)Half of the gametes carry the mutation.
C)All of the gametes carry the mutation.
D)Only a small group of cells within the organism is affected by the mutation.
E)All cells within the organism are affected by the mutation.

Answer 1

D

Question 2

Which of the following is most likely to occur when a tumor-suppressor gene is mutated,resulting in cancer?

A)The resulting tumor-suppressor protein will be overexpressed.
B)The resulting tumor-suppressor protein would further suppress cell proliferation.
C)The resulting tumor-suppressor protein would activate an oncogene.
D)The resulting tumor-suppressor protein would lose its ability to suppress cell proliferation.
E)None of the choices are possiblE.

Answer 2

D

Question 3

Which of the following is an overgrowth of cells that serves no useful purpose?

A)tumor
B)oncogene
C)proto-oncogene
D)apoptosis
E)carcinogen

Answer 3

A

Question 4

All of the following are chemical mutagens EXCEPT

A)nitrogen mustard.
B)X-rays.
C)ethyl methanesulfonate.
D)benzo(a)pyrene.
E)nitrous acid.

Question 5

When cancer cells have the ability to migrate to other parts of the body,they are said to be

A)invasive.
B)benign.
C)metastatiC.
D)oncogenic.
E)genetic.

Question 6

What type of gene mutation occurred to produce the following protein sequence?
Normal: JAYBIRDCATPAW
Mutated: JAYBIRDBATPAW

A)nonsense
B)missense
C)silent
D)sense
E)frameshift

Question 7

Which of the following would occur from a mutation in the gene's promoter region?

A)The sequence of the mature mRNA would change.
B)The ability of pre-mRNA to be properly spliced would change.
C)The ability of mRNA to be translationally regulated would change.
D)The amino acid sequence of the translated protein would be altereD.
E)The rate of transcription may increase or decreasE.

Question 8

What would result from a single nucleotide deletion (point mutation)within the coding sequence of a structural gene?

A)a silent point mutation with no deleterious effects
B)a missense point mutation resulting in the change of one amino acid
C)a nonsense point mutation resulting in the generation of a premature stop codon
D)a frameshift mutation,producing a completely different amino acid sequence
E)All of the choices are possiblE.

Question 9

Which of the following diseases is associated with faulty DNA repair mechanisms?

A)Alzheimer's disease
B)diabetes
C)xeroderma pigmentosum
D)diabetes and xeroderma pigmentosum
E)Alzheimer's disease and diabetes

Question 10

Which of the following statements about cancer is FALSE?

A)It is characterized by uncontrolled cell division.
B)Over 1 million Americans are diagnosed with cancer each year.
C)Most cancers involve genetic changes that are passed from parent to offspring.
D)At least 80% of all human cancers are related to exposure to carcinogens.
E)It is caused by an accumulation of mutations.

Question 11

Ionizing radiation can produce which of the following?

A)cytosine
B)free radicals
C)stop codons
D)thymine dimers
E)hypoxanthine

Question 12

A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to the correct structure.Which of the following DNA repair systems is responsible for the correction?

A)base excision repair
B)direct repair
C)indirect repair
D)nucleotide excision repair
E)mismatch repair

Question 13

In the Ames test,mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium)that cannot synthesize the amino acid histidine.Therefore,these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that in the presence of the new compound,several colonies of Salmonella typhimurium is living on the histidine-free growth plate.What can be assumed from these results?

A)The newly synthesized compound induced a mutation in the bacteriA.
B)The bacteria no longer produce histidine.
C)The bacteria now produce histidine.
D)The newly synthesized compound induced a mutation in the bacteria and the bacteria no longer produce histidine.
E)The newly synthesized compound induced a mutation in the bacteria and the bacteria now produce histidinE.

Question 14

Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

A)base addition - silent
B)substitution - misense
C)base addition - missense
D)substitution - frameshift
E)base addition - frameshift

Question 15

Which of the following types of physical mutagens produces thymine dimer mutations?

A)ultraviolet light
B)X-rays
C)microwave
D)gamma rays
E)ionizing radiation

Question 16

Which of the following LEAST belongs with the others?

A)Ras protein
B)UvrA protein
C)UvrD protein
D)UvrC protein
E)DNA Polymerase

Question 17

Which of the following CANNOT be repaired by nucleotide excision repair (NER)?

A)ultraviolet-induced damage
B)chemically modified bases
C)missing bases
D)mismatched bases
E)thymine dimers

Question 18

Which of the following results in a spontaneous mutation?

A)free radicals produced by cellular metabolism
B)exposure to ultraviolet light
C)exposure to benzo (a)-pyrene,a chemical substance found in cigarette smoke
D)exposure to ultraviolet light and benzo (a)-pyrene
E)exposure to X-rays

Question 19

A mutation causes a gene to become overactive,contributing to uncontrolled cell growth.Which term best describes this gene?

A)tumor-suppressor gene
B)oncogene
C)spliced gene
D)alternatively spliced gene
E)malignant gene

Question 20

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

A)A -T
B)C-G
C)A-G
D)A-G and C-G
E)A-T and C-G

Question 21

Myc genes tend to be overexpressed in only a few forms of cancer.

Question 22

Patients who suffer from xeroderma pigmentosum (XP)have a defective mismatch repair system.

Question 23

p53 is a tumor suppressor gene that acts as a sensor of DNA damage.

Question 24

Most oncogenes encode proteins that function in cell growth signaling pathways.

Question 25

Larger genes are usually more likely to incur a mutation than smaller genes.

Question 26

Mutations can produce a polypeptide with increased function.

Question 27

Which of the following is NOT a typical cellular change that occurs during lung cancer?

A)cellular hyperplasia
B)loss of ciliated cells
C)cellular displasia
D)elevated gas transport
E)increases in basal cell number and thickening of epithelium

Question 28

Cancers originate from a single cell.

Question 29

The timing of a mutation during development has negligible effects on the severity of the genetic defect.

Question 30

The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix.

Question 31

Which of the following events must occur to cause a chromosomal translocation?

A)One chromosome must break in two distinct locations.
B)Two different chromosomes must break.
C)A transposon must be present in one of the chromosomes.
D)The broken ends must pair correctly.
E)A mutation in the DNA must occur.

Question 32

Should a genetic abnormality arise,________ prevent a cell from progressing uncontrollably through the cell cycle.

A)mutagens
B)checkpoint proteins
C)UvrA-D proteins
D)growth factors
E)Ras proteins

Question 33

_______ can convert proto-oncogenes into oncogenes.

A)Gene amplifications
B)Chromosomal translocations
C)Missense mutations
D)All of these choices are correct

Question 34

Cells are normally limited to one DNA repair system that corrects DNA mistakes.

Question 35

If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone

A)a missense mutation.
B)gene amplification.
C)a chromosomal translocation.
D)retroviral insertion.
E)a nonsense mutation.

Question 36

Somatic cell mutations are heritable.

Question 37

Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle?

A)caspases
B)cyclins
C)claudins
D)endonucleases
E)cofactors

Question 38

At what phase of the cell cycle does p53 halt cell division if it senses DNA damage?

A)S
B)G₂
C)M
D)G₀
E)G₁

Question 39

Which protein directs apoptosis?

A)growth factor
B)oncogene
C)chimeric gene
D)caspase
E)transposase

Question 40

A gene created from the fusion of two gene fragments is considered a

A)tumor-suppressor gene.
B)proto-oncogene.
C)structural gene.
D)regulatory gene.
E)chimeric genE.

Question 41

Beta-thalassemia is a disease that results from the reduction or absence of a functional $\beta$ -globin gene.It results in patients that exhibit moderate to severe anemia,poor growth,and possibly skeletal abnormalities.Depending on how severe a patient presents,they may need regular to periodic blood transfusions throughout their life.It is known that there are various mechanisms of mutation that result in beta-thalassemia.You are studying a group of individuals with beta-thalassemia in order to better understand the disease.Upon sequencing the $\beta$ -globin gene,you notice that only about half of the patients in your study have deletions in their $\beta$ -globin gene.The other half has no abnormalities in the sequence of this gene.From other tests,you know that these patients do in fact have beta-thalassemia,as they are deficient in $\beta$ -globin protein and other members of their families also suffer from similar conditions.What is the most likely explanation for the presence of this genetic disease in these people?

A)There is a mutation in the promoter of the $\beta$ -globin gene preventing adequate expression of the protein.
B)There was an inversion with a splice point within the $\beta$ -globin gene.
C)There is a microorganism,such as a virus,that is causing these symptoms.
D)The patients actually have bone marrow cancer that is causing these symptoms.
E)The patients actually have sickle-cell anemia.

Question 42

Women are cautioned against having children later in life because the incidence of Down syndrome (trisomy 21)increases rapidly with age.What is the best explanation for this phenomenon?

A)Somatic mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
B)Germ line mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
C)Germ line mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
D)Somatic mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
E)Somatic mutations accumulate as a woman ages,so the developing embryo is more likely to acquire mutations that lead to down syndromE.

Question 43

Study the mutations described below and determine which one is most likely to lead to cancer.

A)A mutation in the Ras protein increases its affinity for GDP.
B)A mutation in the Ras protein that prevents GTP hydrolysis.
C)A mutation in a receptor protein that decreases its affinity for a growth factor.
D)A mutation in a transcription factor that prevents it from binding to the DNA to transcribe genes that promote cell division.
E)All of these mutations might lead to cancer.

Question 44

Study the loci that have been identified on the two non-homologous chromosomes below and determine what mutation is the most likely to lead to cancer.

A)A reciprocal translocation switches the entire long arm of one chromosome with the entire long arm of the other chromosome.
B)An inversion switches the position of the blue and purple genes.
C)An inversion switches the position of the red and orange regions.
D)A deletion occurs in the green gene,so that it no longer binds to org,but instead binds to the purple gene.
E)A deletion occurs in the green gene,so that it no longer binds to org,but instead binds to the blue genE.

Question 45

Study the figure below of two non-homologous chromosomes.Several loci have been identified on these chromosomes.Next,study the changes that have taken place,resulting in the mutated chromosomes,and determine which mutated chromosomes are the most likely to lead to cancer?
Normal Chromosomes
Mutated Chromosomes

A)A
B)B
C)C
D)D
E)A,B,C,and D are all mutations,so they will all lead to cancer

Question 46

Study the mutations below and determine which is the most likely to lead to cancer.

A)A mutation that increases the affinity of Rb for E2F
B)A mutation that prevents the phosphorylation of Rb
C)A mutation that prevents E2F from associating with DNA
D)A mutation that caused the cyclin-dependent kinase that interacts with Rb to be overactive
E)All of these are mutations that would lead to cancer

Question 47

You are a brilliant graduate student and you are skeptical of the results found by the Lederbergs.You decide to repeat their experiment,but you do not have ready access to T1 bacteriophage.What might you use instead?

A)HIV virus
B)HPV virus
C)X-gal - the substrate of the enzyme $\beta$ -galactosidase
D)Ampicillin - an antibiotic
E)Salmonella bacteria

Question 48

The Lederbergs conducted an experiment that showed that mutations were random events.The alternative view,proposed by Lamarck,predicted that organisms changed in response to their environment and would pass on that change to their offspring.If Lamarck's hypothesis was correct,what results would you expect the Lederbergs to have seen?

A)There would have been no bacterial colonies on the master plate or on the plates with the T1 phage.
B)There would have been no bacterial colonies on the master plate,but there would have been copious amouts on the plates with the T1 phage.
C)There would be bacterial colonies on the master plate and there would be a few colonies growing on plates with the T1 phage,but the two plates with T1 phage would have colonies growing in different locations.
D)There would have been bacterial colonies on the master plate and all of those colonies would be present on the plates with the T1 phage.
E)You would need to design a completely different experiment to test Lamarck's hypothesis.