Deck 16: Genetic Technology

Question 1

You insert a fragment of sheep DNA into a plasmid containing an Amp^R gene.You transform bacteria with the recombinant plasmid,and plate the cells on growth media containing the antibiotic ampicillin.Each colony on the plate arose from _____ that ____ to ampicillin.

A)a single cell;is sensitive
B)many bacteria;are resistant
C)many bacteria;are sensitive
D)a single cell;is resistant

Answer 1

D

Question 2

You grow a culture of bacteria and split it into two culture tubes.One sample of bacteria you treat with calcium and the other is not treated.You then attempt to transform the two samples with a plasmid.Both samples survive,but only the samples treated with calcium take up the plasmid.What is the most likely explanation for your results?

A)The bacteria use calcium as a source of energy to take up the DNA.
B)DNA is degraded in the absence of calcium.
C)The calcium makes the bacterial membrane more porous to DNA.
D)Calcium precipitates DNA,preventing it from being taken up by cells.
E)The bacteria require calcium to grow.

Answer 2

C

Question 3

Which of the following sequence pairs is a palindrome?

A)5'-TCACGT-3'
3'-TCACGT-5'
B)5'-GAATCG-3'
3'-CTTAGC-5'
C)None of the paired sequences are a palindrome.
D)5'-GTTCAT-3'
3'-CAAGTA-5'
E)5'-TCCGGA-3'

Answer 3

5'-TCCGGA-3'

Question 4

After a fragment of DNA containing the gene of interest has been inserted into a vector,how are the gaps between the two pieces of DNA sealed together?

A)DNA polymerase catalyzes the formation of hydrogen bonds in the DNA backbone.
B)DNA gyrase creates tension in the DNA backbone to hold the molecule together.
C)DNA helicase causes the double helix to wind into its stable form.
D)DNA ligase catalyzes the formation of covalent bonds in the DNA backbone.
E)Restriction enzymes have the ability to join the two DNA fragments.

Question 5

You cut some sheep DNA and some plasmid DNA with the same restriction enzyme.The plasmid contains an Amp^R gene and a lacZ gene.You mix together the fragments of sheep DNA and the linearized plasmid.You transform bacteria with your mixture,and plate the bacterial cells on growth media containing the antiobiotic ampicillin and X-gal (the substrate of beta-galactosidase).You need to pick the bacterial colonies that contain recombinant plasmids.Which colonies do you choose?

A)only the blue colonies - these contain recombinant plasmids
B)only the white colonies - these contain recombinant plasmids
C)the largest colonies - these are the most resistant to ampicillin and thus more likely to contain a recombinant plasmids
D)all colonies will contain plasmids,but additional testing is needed to determine if the plasmids are recombinant
E)all surviving colonies;if they grow on the media they are ampicillin-resistant and contain recombinant plasmids

Question 6

What is TRUE of restriction enzymes?

A)they randomly cleave DNA at sites within a genome
B)they catalyze the formation of hydrogen bonds between DNA fragments
C)they protect bacterial cells from invasion by foreign DNA
D)they are not naturally produced by bacteria,but are bioengineered by humans
E)there are less than 10 restriction enzymes known

Question 7

The lacZ gene encodes

A)aromatase
B)glucose dehydrogenase
C)ampicillin-resistance protein
D)b-galactosidase
E)lactose

Question 8

What is true of cDNA produced using horse liver tissue as a starting material?

A)it could be used to create a library of genes expressed in horse liver
B)it is produced from tRNA using reverse transcriptase
C)it contains just the introns of genes from horse liver cells
D)it could be used to study how bacterial cells splice introns
E)it is produced using chromosomal DNA and DNA polymerase

Question 9

Shown below is a diagram for a plasmid vector you want to use to clone a gene.The diagram shows the location of the recognition sites for four restrictions enzymes,BamHI (B),EcoRI (E),HindIII (H),and XhoI (X).The genes encoding beta-lactamase (Amp^R)and beta-galactosidase (lacZ),which you plan to use as selectable markers,are also indicated.If you were to use this plasmid as a vector,which restriction enzyme would be most useful to prepare it for cloning?

A)BamHI
B)EcoRI
C)HindIII
D)XhoI
E)BamHI or XhoI would be equally useful.

Question 10

You transform bacteria with a plasmid carrying the ampicillin-resistance gene amp^R. How would you determine which bacteria took up the plasmid?

A)Bacteria containing the plasmid would be able to grow in the absence of ampicillin.
B)Ampicillin-resistance is necessary for the plasmid DNA to get into the bacteria.
C)Bacteria containing the plasmid would be killed in the presence of ampicillin.
D)Bacteria containing the plasmid would be able to produce ampicillin.
E)Bacteria containing the plasmid would be able to grow in the presence of ampicillin.

Question 11

Which of the following stretches of double-stranded DNA is mostly likely to be recognized as a restriction enzyme cutting site and create fragments with sticky ends?

A)5'-GTTCAT-3'
3'-CAAGTA-5'
B)5'-ACCCCT-3'
3'-TGGGGA-5'
C)5'-TCCGGA-3'
3'-AGGCCT-5'
D)5'-TTTTTT-3'
3'-AAAAAA-5'
E)5'-GAATCG-3'

Question 12

Gene cloning

A)is the process of making multiple copies of a gene
B)is the process of isolating a particular gene of interest
C)is the process of determining the nucleotide sequence of a gene of interest
D)is the process of taking a gene of interest in one organism and putting it into another organism
E)is the process of making an organism that is genetically identical to its parent and its siblings

Question 13

Restriction enzymes are invaluable tools in gene cloning because

A)they cut both strands of DNA at specific sites
B)they replicate the gene of interest
C)they can produce sticky ends so DNA from different sources can be joined together
D)they cut at specific sites within the DNA and produce sticky ends allowing DNA from different sources to be joined together
E)they replicate the DNA of interest,they cut at specific sites within the DNA,and produce sticky ends allowing DNA from different sources to be joined together

Question 14

A plasmid that has genes for both tetracycline resistance and ampicillin resistance is cut with the restriction enzyme BamHI.BamHI cuts within the ampicillin resistance gene.Caenorhabditis elegans DNA that has been cut with BamHI is ligated into the linearized plasmid to make a genomic DNA library.The mixture is transformed into

A)Both ampicillin and tetracycline are needed to make this determination.
B)tetracycline
C)Neither ampicillin or tetracycline are needed to make this determination.
D)ampicillin
E)coli.What antibiotic(s),if any,should be added to the medium to determine which cells contain plasmids?

Question 15

What is the most likely consequence of using a plasmid that lacks an origin of replication for a gene cloning project?

A)No recombinant plasmids will be created because the plasmid is only capable of re-circularizing.
B)Bacteria containing the plasmid will not be able to grow in the presence of antibiotics.
C)The plasmid will not be cut with restriction enzymes.
D)Multiple copies of the gene of interest will not be produced because the plasmid will be lost during bacterial division.
E)The plasmid will not be useful in producing a protein because it will lack an RNA polymerase binding sitE.

Question 16

In order to produce human insulin in bacteria what must be done first?

A)The human insulin gene must be transformed into bacteriA.
B)Bacteria containing the human insulin gene are grown.
C)The coding sequence of the genes which produce human insulin must be isolated.
D)The bacterial insulin gene must be cloneD.
E)Human insulin protein is purified from the bacteria.

Question 17

Which of the following vectors must undergo transformation in order to achieve gene cloning?

A)fungus
B)bacteriophage
C)yeast
D)virus
E)plasmid

Question 18

What statement concerning types of DNA libraries is true?

A)a cDNA library is derived from chromosomal DNA
B)a genomic library is derived from mRNA
C)a genomic library is made using mitochondrial DNA
D)a genomic library is derived from mRNA and is made using reverse transcriptase
E)a cDNA library is derived from mRNA and is made using reverse transcriptase

Question 19

A DNA library is

A)a collection of recombinant vectors containing DNA fragments of a given organism
B)a collection of books about clones
C)a line of bacteria that contains a DNA fragment of interest
D)a series of restriction enzymes that can be used to produce a variety of sizes of DNA fragments
E)a collection of recombinant plasmids containing a particular gene from many different organisms

Question 20

A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.The digested plasmid and chromosomal DNA were incubated together with DNA ligase and transformed into bacteria.Plasmids isolated from some of the colonies do not contain inserted chromosomal DNA.What is the most likely explanation for this observation?

A)The chromosomal DNA did not have any restriction sites for the enzyme used.
B)The two sticky ends of the plasmid can hybridize to both sticky ends of the chromosomal DNA fragments.
C)The two sticky ends of the plasmid can hybridize back together,recircularizing.
D)The two sticky ends of the vector can remain free or unhybridizeD.
E)The two sticky ends of the plasmid can hybridize with only one end of the chromosomal DNA fragments

Question 21

A small amount of DNA is collected from a crime scene.However,the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime.Which method could be utilized to increase the amount of DNA?

A)microarray analysis
B)gel electrophoresis
C)polymerase chain reaction (PCR)
D)fluorescent labeling of DNA
E)DNA sequencing

Question 22

You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer.You have several genes you think may be involved,so you "print" spots of the DNA sequences of interest on a microarray slide.After doing this,you isolate mRNA from both normal lung cells and cancerous lung cells.Before you use these mRNAs to probe the microarray slide,what do you need to do?

A)make cDNA and amplify the cDNA using PCR
B)sequence the mRNA
C)clone each mRNA into a BAC vector
D)amplify the mRNA using PCR
E)add reverse transcriptase and fluorescent nucleotides to the mRNA to make cDNA

Question 23

You analyze some DNA using an automated sequence reaction.The first peak you observe is labeled with a red fluorescent label.From this you can conclude that the most ____ base in the DNA is a _____ containing the red fluorescent label.

A)5',dideoxynucleotide
B)3',deoxynucleotide
C)5',deoxynucleotide
D)3',dideoxynucleotide

Question 24

You cut a plasmid with a restriction enzyme that cuts it into three pieces - one fragment is 240 base pairs,one fragment is 600 base pairs,and one fragment is 1200 base pairs.You carry out electrophoresis of the digested sample.After ten minutes,which of the fragments,if any,will be closest to the top of the gel where the samples were inserted?

A)the 240 base pair fragment
B)the 600 base pair fragment
C)the 1200 base pair fragment
D)all three fragments will be equally near the top because of their identical sticky ends
E)it depends on the charge of the DNA fragment

Question 25

Shown below is the output from an automated sequencing reaction.What is the sequence of the DNA template strand?

A)5' - CCTGATAGAGTCTCCCT - 3'
B)3' - CCTGATAGAGTCTCCCT - 5'
C)3' - GGACTATCTCAGAGGGA - 5'
D)5' - GGACTATCTCAGAGGGA - 3'
E)5' - CCTGATAGAGTCTCCCT - 3'

Question 26

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use?
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

A)5' - AGGGC- 3' and 5' -GATTG- 3'
B)5' -CAATC- 3' and 5' -GCCCT- 3'
C)3' -CAATC- 5' and 3' -GCCCT- 5'
D)3' - AGGGC- 5' and 3' -GATTG- 5'
E)5' -GTTAG -3' and 5' -ATCCC -3'

Question 27

The FtsZ gene in bacteria encodes an ancestral tubulin that is important in binary fission (the mechanism of cell division in prokaryotes).To study the FtsZ gene in eukaryotes,researchers made an FtsZ knockout in the moss What statement about this knockout plant is accurate?

A)The knockout plant is heterozygous for an abnormal eukaryotic FtsZ gene
B)The knockout plant does not produce any normal FtsZ protein
C)The knockout plant contains a copy of the normal bacterial FtsZ gene
D)The knockout plant makes abnormal bacterial FtsZ protein
E)The knockout plant makes half the normal amount of FtsZ protein

Question 28

_____ occurs when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO).

A)recombination
B)gene replacement
C)transformation
D)molecular pharming
E)gene knockout

Question 29

In a DNA microarray,_____ are attached to the slide and ___ are fluorescently labeled.

A)the cDNAs,the genes
B)the mRNAs,the genes
C)the samples,the cDNAs
D)the samples,the mRNAs
E)the nucleotides,the cells

Question 30

A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots)into a mammal so that the protein will be secreted into the milk of the mammary gland.What is required for the researcher's success?

A)The gene should be placed a considerable distance away from the promoter of a gene that is expressed in mammary cells
B)The gene should be placed next to the promoter of a gene that is expressed in mammary cells
C)The gene should be inserted in place of the promoter of a gene that is expressed in mammary cells
D)The gene should be placed next to the promoter of a gene that is expressed in multiple types of cells
E)The gene should be inserted in place of the promoter of a gene that is expressed in multiple types of cells

Question 31

Following treatment with restriction enzymes,what procedure would be used to separate DNA fragments of different lengths?

A)transformation
B)amplification
C)gel electrophoresis
D)polymerase chain reaction
E)microarray analysis

Question 32

Why is Taq polymerase used in a polymerase chain reaction (PCR)?

A)Taq polymerase has proofreading activity and thus makes fewer errors than other DNA polymerases.
B)Taq polymerase is more efficient than other DNA polymerases.
C)Taq polymerase can produce DNA from an RNA template,unlike other DNA polymerases.
D)Unlike other DNA polymerases,Taq polymerase is not inhibited by dideoxy nucleotides.
E)Unlike other DNA polymerases,Taq polymerase is heat stable and survives the 94 degree denaturation step in PCR.

Question 33

Primers are used in both PCR and in DNA sequencing.What is the purpose of the primers?

A)to provide a 3'- OH for DNA polymerase to build a new DNA strand
B)to terminate synthesis of the growing DNA strand
C)to add nucleotides to a growing DNA strand
D)to separate the DNA template strands
E)to separate various-sized DNA products

Question 34

The protein p53 is a tumor suppressor - it regulates the cell cycle and is important in preventing cancer in humans.What phenotype would you expect in p53 knockout mice?

A)cells of p53 knockout mice would not be able to go through mitosis
B)cells of p53 knockout mice would not be able to go through meiosis
C)p53 knockout mice would be less susceptible to cancer
D)p53 knockout mice would be more susceptible to cancers

Question 35

You have the target DNA and primers shown below.You add the target DNA and primers,along with dATP,dTTP,dGTP,dCTP and Taq DNA polymerase to a test tube.After 30 cycles of PCR,which of the following is true about the DNA in your test tube?
Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
Primer 1: 5' - GATCAA - 3'
Primer 2: 5' - CGGAAA - 3'

A)There will be around a billion DNA molecules and most will look just like the template
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
B)There will be around a billion DNA molecules and most will be single stranded,either
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
C)Only the template and primers will be present;since no DNA helicase was added the strands won't separate so no new DNA can be made
D)There will be around a billion DNA molecules and most will contain the region that is flanked by the primers
5' - GATCAATCAATGCCGAATTTCCG - 3'
3' - CTAGTTAGTTACGGCTTAAAGGC - 5'
E)There will be around a million DNA molecules of various sizes,depending on where chain termination occurred

Question 36

What field of science is a researcher practicing if she is conducting experiments which attempt to map the location of a gene on a particular chromosome?

A)genomics
B)reproductive genomics
C)functional genomics
D)proteomics
E)electrophoresis

Question 37

What is an advantage of cDNA libraries over genomic libraries?

A)cDNA libraries are more stable than genomic libraries.
B)cDNA lacks exons.
C)cDNA libraries require fewer steps to make than genomic libraries.
D)cDNA only contains protein coding exons.
E)cDNA libraries are cheaper to make than genomic libraries.

Question 38

Dideoxy nucleotides are used in which of the following processes?

A)Microarray analysis
B)DNA sequencing
C)PCR
D)Transformation
E)making a recombinant plasmid

Question 39

What is an advantage of molecular pharming compared to expression of mammalian proteins in bacteria?

A)molecular pharming is less complex because it does not require the use of plasmid vectors
B)molecular pharming produces fewer waste products because the protein yield is smaller than when using bacteria
C)molecular pharming is less expensive than producing proteins in bacteria
D)molecular pharming is less complex because post-translational modifications do not occur in mammals
E)proteins are more likely to function properly when expressed in mammals than when expressed in bacteria

Question 40

You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer.You have several genes you think may be involved,so you "print" spots of the candidate DNA sequences on a microarray slide.After doing this,you isolate mRNA from both normal lung cells and cancerous lung cells.You make fluorescently-tagged cDNA from each mRNA sample;the cDNAs from normal cells are tagged with a green-colored molecule and the cDNAs from cancer cells are tagged with a red-colored molecule.You hybridize the cDNAs with the microarray and get the following data.(Green spots are labeled with "G",red spots are labeled with "R").
What spots represent DNA that you should study further as potentially having a role in lung cancer?

A)Spots A1 and C6
B)Spots B4 and B6
C)Spots A1,B4,B6,and C6
D)All spots except A1 and C6
E)All spots except A1,B4,B6,and C6

Question 41

Which of the following is an example of a clone on the organism level?

A)identical twins
B)fraternal twins
C)plants grown from seeds collected from the same plant
D)offspring produced using in vitro fertilization
E)chicks hatched from the clutch of eggs

Question 42

The main purpose of polymerase chain reaction (PCR)is to generate many copies of a region of DNA.

Question 43

If you have a double stranded synthetic piece of DNA that you want to attach to a PCR product,what enzyme would you use?

A)Taq DNA polymerase
B)reverse transcriptase
C)DNA ligase
D)DNA polymerase
E)restriction enzyme

Question 44

Restriction enzymes bind to specific sequences of DNA to seal them together.

Question 45

The milk of goats has been genetically modified to produce human antithrombin,a protein with anticoagulant properties.How did the recombinant plasmid containing the human antithrombin gene get into the goats?

A)the goats ingested bacterial pellets containing the recombinant plasmid,the DNA then integrated into their cells
B)the recombinant plasmid was injected into mammary cells
C)the recombinant plasmid was put into a goat oocyte,which was in turn fertilized and implanted into a surrogate goat mother
D)the recombinant plasmid was put into a viral vector;the virus then infected the goat cells
E)the goat cells were treated with chemical agents such as calcium chloride,which made them competent to take up DNA

Question 46

The first human gene therapy was approved for patients suffering ADA (adenosine deaminase)deficiency.In this therapy,lymphocytes were removed from the patient,the normal ADA gene was put into the cells,and the cells were returned to the bloodstream.How was the normal ADA put into the lymphocytes?

A)via the polymerase chain reaction
B)via a plasmid vector
C)microinjection
D)by fusing normal lymphocytes with deficient lymphocytes
E)via a viral vector

Question 47

To study the promoter of a gene,a researcher should use a cDNA library.

Question 48

DNA microarrays (gene chips)are only capable of monitoring the expression of one gene at a time.

Question 49

Why is the production of transgenic plants somewhat easier than the production of transgenic animals?

A)plant cells lack cell walls,so uptake of DNA is easier than in animal cells
B)plant cells are more stable than animal cells
C)plant cells are totipotent
D)plant cells are more highly evolved as they contain both chloroplasts and mitochondria
E)all of the above are reasons why plant cells are more easily transformed than animal cells

Question 50

Chromosomes within somatic cells of mammals cannot be cloned because they accumulate irreversible genetic changes.

Question 51

Most plasmids used in biotechnology contain a selectable marker such as an antibiotic-resistance (amp^R)gene.

Question 52

Shown below are steps in making a transgenic plant.
1)Expose plant cells to Agrobacterium tumefaciens
2)Place plant cells on selective medium
3)Transform the recombinant plasmid into Agrobacterium tumefaciens
4)Insert gene of interest into Ti plasmid
5)Place plant cells on growth medium with plant hormones
What is the correct order of these steps?

A)5 - 1 - 4 - 3 - 2
B)4 - 3 - 1 - 2 - 5
C)4 - 1 - 3 - 5 - 2
D)2 - 4 - 1 - 3 - 5
E)None of the choices shows the correct order

Question 53

What statement about the modified Ti plasmid used to make transgenic plants is accurate?

A)it is derived from a virus that infects the bacterium Agrobacterium tumefaciens
B)it causes crown gall formation
C)it contains a screenable marker gene
D)it contains a cDNA region that integrates into the plant cell's genome
E)it has its restriction enzyme recognition sites removed

Question 54

A genomic DNA library is derived from mRNA.

Question 55

How would you accurately summarize the process used to make Dolly the sheep?

A)Mitochondrial DNA was taken from one female and injected into the mammary glands of another female.
B)A sheep embryo was produced by in vitro fertilization.At an early stage,the cells of the embryo were separated,and each cells was put into a surrogate sheep mother.
C)A mammary cell of one sheep was fused with an enucleated egg of another sheep.The resulting diploid embryo was placed in a surrogate sheep mother.
D)A set of twins - one male and one female - were mateD.Since the twins had identical DNA,their lamb was a clone.
E)The sheep to be cloned was given a drug that induced the cells of her ovary to divide by binary fission.The resulting diploid eggs did not need to be fertilized,and were used to produce sheep embryos,including Dolly.