You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use?
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A) 5' - AGGGC- 3' and 5' -GATTG- 3'
B) 5' -CAATC- 3' and 5' -GCCCT- 3'
C) 3' -CAATC- 5' and 3' -GCCCT- 5'
D) 3' - AGGGC- 5' and 3' -GATTG- 5'
E) 5' -GTTAG -3' and 5' -ATCCC -3'
Correct Answer:
Verified
Q21: A small amount of DNA is collected
Q22: You are working in a cancer lab
Q23: You analyze some DNA using an automated
Q24: You cut a plasmid with a restriction
Q25: Shown below is the output from an
Q27: The FtsZ gene in bacteria encodes an
Q28: _ occurs when a cloned gene recombines
Q29: In a DNA microarray,_ are attached to
Q30: A researcher wants to introduce the human
Q31: Following treatment with restriction enzymes,what procedure would
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents