Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 
A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Correct Answer:
Verified
Q16: A promoter would be located on
A) the
Q17: If a strand of DNA has the
Q18: The bases present in an RNA molecule
Q19: Prokaryotes lack membrane-bound organelles and thus do
Q20: How does a molecule of RNA polymerase
Q22: Which of the following is NOT a
Q23: The process depicted in the following figure
Q24: Which molecules are involved in translation?
A) DNA
Q25: What is the sequence of the codon
Q26: Bacteria and humans use the same DNA
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents