Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?
A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop
Correct Answer:
Verified
Q7: What are the noncoding segments of DNA
Q16: During transcription, adenine is complementary to _.
A)
Q24: What does it mean that the genetic
Q27: Eukaryotic post-transcriptional modifications occur in the _.
A)
Q30: Which nucleotide is added to the end
Q33: In prokaryotes, transcription occurs in the _.
A)
Q35: tRNA differs from other types of RNA
Q36: How many nucleotides comprise one codon?
A) 2
B)
Q37: Which enzyme unwinds the DNA during transcription?
A)
Q39: Which of the following carries amino acids
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents