A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA
(2)CGTACATCTGAGGGTACGATCATGGC
(3)CATGGCTAGCAAACGCGATCCCAAG
(4)AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?
A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

Question

Quizplus · Accepted Answer

The Answer of A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA
(2)CGTACATCTGAGGGTACGATCATGGC
(3)CATGGCTAGCAAACGCGATCCCAAG
(4)AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?
A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

A DNA Sequence Has Been Cut into the Four Overlapping